ACOD1, rather than itaconate, facilitates p62-mediated activation of Nrf2 in microglia post spinal cord contusion.

BACKGROUND: Spinal cord injury (SCI)-induced neuroinflammation and oxidative stress (OS) are crucial events causing neurological dysfunction. Aconitate decarboxylase 1 (ACOD1) and its metabolite itaconate (Ita) inhibit inflammation and OS by promoting alkylation of Keap1 to induce Nrf2 expression; however, it is unclear whether there is another pathway regulating their effects in inflammation-activated microglia after SCI. METHODS: Adult male C57BL/6 ACOD1-/- mice and their wild-type (WT) littermates were subjected to a moderate thoracic spinal cord contusion. The degree of neuroinflammation and OS in the injured spinal cord were assessed using qPCR, western blot, flow cytometry, immunofluorescence, and trans-well assay. We then employed immunoprecipitation-western blot, chromatin immunoprecipitation (ChIP)-PCR, dual-luciferase assay, and immunofluorescence-confocal imaging to examine the molecular mechanisms of ACOD1. Finally, the locomotor function was evaluated with the Basso Mouse Scale and footprint assay. RESULTS: Both in vitro and in vivo, microglia with transcriptional blockage of ACOD1 exhibited more severe levels of neuroinflammation and OS, in which the expression of p62/Keap1/Nrf2 was down-regulated. Furthermore, silencing ACOD1 exacerbated neurological dysfunction in SCI mice. Administration of exogenous Ita or 4-octyl itaconate reduced p62 phosphorylation. Besides, ACOD1 was capable of interacting with phosphorylated p62 to enhance Nrf2 activation, which in turn further promoted transcription of ACOD1. CONCLUSIONS: Here, we identified an unreported ACOD1-p62-Nrf2-ACOD1 feedback loop exerting anti-inflammatory and anti-OS in inflammatory microglia, and demonstrated the neuroprotective role of ACOD1 after SCI, which was different from that of endogenous and exogenous Ita. The present study extends the functions of ACOD1 and uncovers marked property differences between endogenous and exogenous Ita. KEY POINTS: ACOD1 attenuated neuroinflammation and oxidative stress after spinal cord injury. ACOD1, not itaconate, interacted with p-p62 to facilitate Nrf2 expression and nuclear translocation. Nrf2 was capable of promoting ACOD1 transcription in microglia.

Effect of Cyclic Adenosine Monophosphate on Connexin 37 Expression in Sheep Cumulus-Oocyte Complexes.

Gap junctional connection (GJC) in the cumulus-oocyte complex (COC) provides necessary support for message communication and nutrient transmission required for mammalian oocyte maturation. Cyclic adenosine monophosphate (cAMP) is not only a prerequisite for regulating oocyte meiosis, but also the key intercellular factor for affecting GJC function in COCs. However, there are no reports on whether cAMP regulates connexin 37 (Cx37) expression, one of the main connexin proteins, in sheep COCs. In this study, the expression of Cx37 protein and gene in immature sheep COC was detected using immunohistochemistry and PCR. Subsequently, the effect of cAMP on Cx37 expression in sheep COCs cultured in a gonadotropin-free culture system for 10 min or 60 min was evaluated using competitive ELISA, real-time fluorescent quantitative PCR (RT-qPCR), and Western blot. The results showed that the Cx37 protein was present in sheep oocytes and cumulus cells; the same results were found with respect to GJA4 gene expression. In the gonadotropin-free culture system, compared to the control, significantly higher levels of cAMP as well as Cx37 gene and protein expression were found in sheep COCs following treatment in vitro with Forskolin and IBMX (100 µM and 500 µM)) for 10 min (p < 0.05). Compared to the controls (at 10 or 60 min), cAMP levels in sheep COCs were significantly elevated as a result of Forskolin and IBMX treatment (p < 0.05). Following culturing in vitro for 10 min or 60 min, Forskolin and IBMX treatment can significantly promote Cx37 expression in sheep COCs (p < 0.05), a phenomenon which can be counteracted when the culture media is supplemented with RP-cAMP, a cAMP-specific competitive inhibitor operating through suppression of the protein kinase A (PKA). In summary, this study reports the preliminary regulatory mechanism of cAMP involved in Cx37 expression for the first time, and provides a novel explanation for the interaction between cAMP and GJC communication during sheep COC culturing in vitro.

Predictive value of CT and 18F-FDG PET/CT features on spread through air space in lung adenocarcinoma.

BACKGROUND: Lung adenocarcinoma, a leading cause of cancer-related mortality, demands precise prognostic indicators for effective management. The presence of spread through air space (STAS) indicates adverse tumor behavior. However, comparative differences between 18F-fluorodeoxyglucose (18F-FDG) positron emission tomography(PET)/computed tomography(CT) and CT in predicting STAS in lung adenocarcinoma remain inadequately explored. This retrospective study analyzes preoperative CT and 18F-FDG PET/CT features to predict STAS, aiming to identify key predictive factors and enhance clinical decision-making. METHODS: Between February 2022 and April 2023, 100 patients (108 lesions) who underwent surgery for clinical lung adenocarcinoma were enrolled. All these patients underwent 18F-FDG PET/CT, thin-section chest CT scan, and pathological biopsy. Univariate and multivariate logistic regression was used to analyze CT and 18F-FDG PET/CT image characteristics. Receiver operating characteristic curve analysis was performed to identify a cut-off value. RESULTS: Sixty lesions were positive for STAS, and 48 lesions were negative for STAS. The STAS-positive was frequently observed in acinar predominant. However, STAS-negative was frequently observed in minimally invasive adenocarcinoma. Univariable analysis results revealed that CT features (including nodule type, maximum tumor diameter, maximum solid component diameter, consolidation tumor ratio, pleural indentation, lobulation, spiculation) and all 18F-FDG PET/CT characteristics were statistically significant difference in STAS-positive and STAS-negative lesions. And multivariate logistic regression results showed that the maximum tumor diameter and SUVmax were the independent influencing factors of CT and 18F-FDG PET/CT in STAS, respectively. The area under the curve of maximum tumor diameter and SUVmax was 0.68 vs. 0.82. The cut-off value for maximum tumor diameter and SUVmax was 2.35 vs. 5.05 with a sensitivity of 50.0% vs. 68.3% and specificity of 81.2% vs. 87.5%, which showed that SUVmax was superior to the maximum tumor diameter. CONCLUSION: The radiological features of SUVmax is the best model for predicting STAS in lung adenocarcinoma. These radiological features could predict STAS with excellent specificity but inferior sensitivity.

Preclinical evaluation of the SARS-CoV-2 Mpro inhibitor RAY1216 shows improved pharmacokinetics compared with nirmatrelvir.

Although vaccines are available for SARS-CoV-2, antiviral drugs such as nirmatrelvir are still needed, particularly for individuals in whom vaccines are less effective, such as the immunocompromised, to prevent severe COVID-19. Here we report an α-ketoamide-based peptidomimetic inhibitor of the SARS-CoV-2 main protease (Mpro), designated RAY1216. Enzyme inhibition kinetic analysis shows that RAY1216 has an inhibition constant of 8.4 nM and suggests that it dissociates about 12 times slower from Mpro compared with nirmatrelvir. The crystal structure of the SARS-CoV-2 Mpro:RAY1216 complex shows that RAY1216 covalently binds to the catalytic Cys145 through the α-ketoamide group. In vitro and using human ACE2 transgenic mouse models, RAY1216 shows antiviral activities against SARS-CoV-2 variants comparable to those of nirmatrelvir. It also shows improved pharmacokinetics in mice and rats, suggesting that RAY1216 could be used without ritonavir, which is co-administered with nirmatrelvir. RAY1216 has been approved as a single-component drug named 'leritrelvir' for COVID-19 treatment in China.

Chinese consumers' psychology and behavior of the foods with nutrition claims based on AISAS model.

Objective: We analyzed the impact of nutrition claims on Chinese consumer psychology and behavior process based on the theoretical framework of AISAS (Attention-Interest-Search-Action-Share) model. Design: To adopt questionnaires to collect gender, age, income and other basic information of adult residents and a 5-point Likert scale ranging from 1 (strongly disagree) to 5 (strongly agree) to collect data on residents' attention to nutrition claims, interest in nutrition claims, search on nutrition claim information, purchasing behavior on food with nutrition claims, sharing information on food with nutrition claims. Then to study the relationship between the basic situation of residents and their attention, interest, search, food purchase behavior and sharing of nutrition claims by using exploratory factor analysis, reliability and validity test, structural equation modeling estimation and hypothesis testing. Participants: Chinese adults. Setting: Multi-stage stratified random sampling method was used to collect the valid online questionnaire of 630 Chinese adults from Central, North, East, South, Northwest, Southwest, and Northeast China. Results: Younger adults and those with higher household incomes exhibited heightened attention to nutrition claims. Furthermore, consumers' attention to nutrition claims could be transformed into food information sharing through interest, information search, and food purchase. Consumers' interest in food with nutrition claims could be transformed directly into food purchase. Consumers' search for related information could be directly transformed into food information sharing. Conclusion: Chinese consumers' age and household income could be included in the AISAS model for the foods with nutrition claims, and the consumers' action and share could transform from their interest and search.

Safety and efficacy of onradivir in adults with acute uncomplicated influenza A infection: a multicentre, double-blind, randomised, placebo-controlled, phase 2 trial.

BACKGROUND: Onradivir (ZSP1273) is a novel anti-influenza A virus inhibitor. Preclinical studies show that onradivir can inhibit influenza A H1N1 and H3N2 replication and increase the survival rate of infected animals. In this study, we aimed to evaluate the safety and efficacy of three onradivir dosing regimens versus placebo in outpatients with acute uncomplicated influenza A virus infection. METHODS: We did a multicentre, double-blind, randomised, placebo-controlled, phase 2 trial at 20 clinical sites in China. Eligible participants were adults (18-65 years) with an influenza-like illness screened by rapid antigen testing at the first clinical visit, had the presence of a fever (axillary temperature ≥38·0°C), and had the presence of at least one moderate systemic and one respiratory symptom within 48 h of symptom onset. Patients were excluded if they were pregnant, allergic to onradivir, or had received any influenza antiviral medication within 7 days before enrolment. Participants were randomly assigned (1:1:1:1) into four groups by an interactive web response system: onradivir 200 mg twice per day group, onradivir 400 mg twice per day group, onradivir 600 mg once per day group, and a matching placebo group. A 5-day oral treatment course was initiated within 48 h after symptoms onset. The primary outcome was the time to alleviate influenza symptoms in the modified intention-to-treat population. Safety was a secondary outcome. We evaluated the patients' self-assessed severity of seven influenza symptoms on a 4-point ordinal scale, and the treatment-emergent adverse events in all patients. This trial is registered with ClinicalTrials.gov, number NCT04024137. FINDINGS: Between Dec 7, 2019, and May 18, 2020, a total of 205 patients were screened; of whom, 172 (84%) were randomly assigned to receive onradivir (n=43 in the 200 mg twice per day group; n=43 in the 400 mg twice per day group; and n=43 in the 600 mg once per day group), or placebo (n=42). Median age was 22 years (IQR 20-26). All three onradivir groups showed decreased median time to alleviate influenza symptoms (46·92 h [IQR 24·00-81·38] in the 200 mg twice per day group, 54·87 h [23·67-110·62] in the 400 mg twice per day group, and 40·05 h [17·70-65·82] in the 600 mg once per day) compared with the placebo group (62·87 h [36·40-113·25]). The median difference between the onradivir 600 mg once per day group and the placebo group was -22·82 h (p=0·0330). The most frequently reported treatment-emergent adverse event was diarrhoea (71 [42%] of 171), ranging from 33-65% of the patients in onradivir-treated groups compared with 10% in the placebo group; no serious adverse events were observed. INTERPRETATION: Onradivir showed a safety profile comparable to placebo, as well as higher efficacy than placebo in ameliorating influenza symptoms and lowering the viral load in adult patients with uncomplicated influenza infection, especially the onradivir 600 mg once per day regimen. FUNDING: National Multidisciplinary Innovation Team Project of Traditional Chinese Medicine, National Natural Science Foundation of China, Guangdong Science and Technology Foundation, Guangzhou Science and Technology Planning Project, Emergency Key Program of Guangzhou Laboratory, Macao Science and Technology Development Fund, and Guangdong Raynovent Biotech.

Functional Connectivity Changes in Amygdala Subregions of Obstructive Sleep Apnea Patients After Six Months of Continuous Positive Airway Pressure Treatment.

Purpose: Previous studies demonstrated that there was abnormal functional connectivity (FC) in the amygdala subregions in obstructive sleep apnea (OSA), which was associated with cognitive function. However, it is not clear whether these abnormalities can be improved after continuous positive airway pressure (CPAP) treatment. Therefore, the aim of this research was to investigate the changes in FC of amygdala subregions with other brain regions after 6 months of CPAP treatment (post-CPAP) in patients with OSA. Patients and Methods: Fifteen OSA patients underwent Magnetic Resonance Imaging prior to CPAP treatment (pre-CPAP) and following CPAP treatment. The amygdala was divided into six subregions, including bilateral dorsal amygdala (DA), medial amygdala (MA) and ventral amygdala (VA). The FC was calculated by using the amygdala subregions as seeds. A paired sample T-test was employed to assess alterations in the amygdala subregions FC of pre-CPAP and post-CPAP OSA patients, and correlation analysis was then conducted to evaluate the association between the changed FC and clinical assessment. Results: Compared to pre-CPAP OSA patients, post-CPAP OSA patients displayed an enhanced FC between the left DA and the right posterior cingulate cortex (PCC), whereas the FC between the left MA and the right postcentral gyrus, and between the right MA and the left middle frontal gyrus, decreased. Moreover, significant correlation between the FC value of left DA-right PCC and Hamilton Anxiety Inventory scores was found in pre-CPAP OSA patients. Conclusion: Altered FC between the amygdala subregions and other brain regions in OSA patients induced by CPAP treatment was related to cognitive, emotional, and sensorimotor function. Our study found altered FC between amygdala subregions and cognitive and motor-related brain regions in post-CPAP OSA patients, providing potential neuroimaging indicators for CPAP treatment.

Abnormal temporal variability of thalamo-cortical circuit in patients with moderate-to-severe obstructive sleep apnea.

This study investigated the abnormal dynamic functional connectivity (dFC) variability of the thalamo-cortical circuit in patients with obstructive sleep apnea (OSA) and explored the relationship between these changes and the clinical characteristics of patients with OSA. A total of 91 newly diagnosed patients with moderate-to-severe OSA and 84 education-matched healthy controls (HCs) were included. All participants underwent neuropsychological testing and a functional magnetic resonance imaging scan. We explored the thalamo-cortical dFC changes by dividing the thalamus into 16 subregions and combining them using a sliding-window approach. Correlation analysis assessed the relationship between dFC variability and clinical features, and the support vector machine method was used for classification. The OSA group exhibited increased dFC variability between the thalamic subregions and extensive cortical areas, compared with the HCs group. Decreased dFC variability was observed in some frontal-occipital-temporal cortical regions. These dFC changes positively correlated with daytime sleepiness, disease severity, and cognitive scores. Altered dFC variability contributed to the discrimination between patients with OSA and HCs, with a classification accuracy of 77.8%. Our findings show thalamo-cortical overactivation and disconnection in patients with OSA, disrupting information flow within the brain networks. These results enhance understanding of the temporal variability of thalamo-cortical circuits in patients with OSA.

Leritrelvir for the treatment of mild or moderate COVID-19 without co-administered ritonavir: a multicentre randomised, double-blind, placebo-controlled phase 3 trial.

Background: Leritrelvir is a novel α-ketoamide based peptidomimetic inhibitor of SARS-CoV-2 main protease. A preclinical study has demonstrated leritrelvir poses similar antiviral activities towards different SARS-CoV-2 variants compared with nirmatrelvir. A phase 2 clinical trial has shown a comparable antiviral efficacy and safety between leritrelvir with and without ritonavir co-administration. This trial aims to test efficacy and safety of leritrelvir monotherapy in adults with mild-to-moderate COVID-19. Methods: This was a randomised, double-blind, placebo-controlled, multicentre phase 3 trial at 29 clinical sites in China. Enrolled patients were from 18 to 75 years old, diagnosed with mild or moderate COVID-19 and not requiring hospitalization. Patients had a positive SARS-CoV-2 nucleic acid test (NAT) and at least one of the COVID-19 symptoms within 48 h before randomization, and the interval between the first positive SARS-CoV-2 NAT and randomization was ≤120 h (5 days). Patients were randomly assigned in a 1:1 ratio to receive a 5-day course of either oral leritrelvir 400 mg TID or placebo. The primary efficacy endpoint was the time from the first dose to sustained clinical recovery of all 11 symptoms (stuffy or runny nose, sore throat, shortness of breath or dyspnea, cough, muscle or body aches, headache, chills, fever ≥37 °C, nausea, vomiting, and diarrhea). The safety endpoint was the incidence of adverse events (AE). Primary and safety analyses were performed in the intention-to-treat (ITT) population. This study is registered with ClinicalTrials.gov, NCT05620160. Findings: Between Nov 12 and Dec 30, 2022 when the zero COVID policy was abolished nationwide, a total of 1359 patients underwent randomization, 680 were assigned to leritrelvir group and 679 to placebo group. The median time to sustained clinical recovery in leritrelvir group was significantly shorter (251.02 h [IQR 188.95-428.68 h]) than that of Placebo (271.33 h [IQR 219.00-529.63 h], P = 0.0022, hazard ratio [HR] 1.20, 95% confidence interval [CI], 1.07-1.35). Further analysis of subgroups for the median time to sustained clinical recovery revealed that (1) subgroup with positive viral nucleic acid tested ≤72 h had a 33.9 h difference in leritrelvir group than that of placebo; (2) the subgroup with baseline viral load >8 log 10 Copies/mL in leritrelvir group had 51.3 h difference than that of placebo. Leritrelvir reduced viral load by 0.82 log10 on day 4 compared to placebo. No participants in either group progressed to severe COVID-19 by day 29. Adverse events were reported in two groups: leritrelvir 315 (46.46%) compared with placebo 292 (43.52%). Treatment-relevant AEs were similar 218 (32.15%) in the leritrelvir group and 186 (27.72%) in placebo. Two cases of COVID-19 pneumonia were reported in placebo group, and one case in leritrelvir group, none of them were considered by the investigators to be leritrelvir related. The most frequently reported AEs (occurring in ≥5% of participants in at least one group) were laboratory finding: hypertriglyceridemia (leritrelvir 79 [11.7%] vs. placebo 70 [10.4%]) and hyperlipidemia (60 [8.8%] vs. 52 [7.7%]); all of them were nonserious. Interpretation: Leritrelvir monotherapy has good efficacy for mild-to-moderate COVID-19 and without serious safety concerns. Funding: This study was funded by the National Multidisciplinary Innovation Team Project of Traditional Chinese Medicine, Guangdong Science and Technology Foundation, Guangzhou Science and Technology Planning Project and R&D Program of Guangzhou Laboratory.

[Corrigendum] Long non­coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway.

Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re­examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF­7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'­AGACCATGTGGACCTGTCACTG­3', and reverse, 5'­GTTTGGAGTGGTAGAAATCTGTC­3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'­GAGGCAAAAGTCCTGTGTTCCAACT­3', and reverse, 5'­AAGAAATCCCTGTGGTTGCAGCAGCT­3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti­GAPDH antibodies was incorrectly stated as AbMart Bio­tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033­1042, 2019; DOI: 10.3892/ijo.2019.4679].

Heparanase inhibitor OGT 2115 induces prostate cancer cell apoptosis via the downregulation of MCL­1.

Heparanase (HPSE), an endo-ß-D-glucuronidase, cleaves heparan sulfate and serves an important role in the tumor microenvironment and thus in tumorigenesis. HPSE is known to promote tumor cell evasion of apoptosis. However, the underlying mechanism of this requires further study. In the present study, the results demonstrated that myeloid cell leukemia-1 (MCL-1), an antiapoptotic protein, and HPSE were upregulated in prostate cancer tissues compared with adjacent normal tissues. In addition, the HPSE inhibitor, OGT 2115, inhibited PC-3 and DU-145 prostate cancer cell viability in a dose-dependent manner, with IC50 values of 20.2 and 97.2 µM, respectively. Furthermore, annexin V/PI double-staining assays demonstrated that OGT 2115 induced apoptosis in prostate cancer cells. OGT 2115 treatment markedly decreased MCL-1 protein expression levels, whereas RNA interference-mediated downregulation of MCL-1 and OGT 2115 drug treatment synergistically induced apoptosis in PC-3 and DU-145 cells. In vivo, OGT 2115 40 mg/kg (ig) significantly inhibited PC-3 cell xenograft growth in nude mice and increased the positive TUNEL staining rate of xenograft tissues. It was therefore hypothesized that MCL-1 was an important signaling molecule in OGT 2115-induced apoptosis. The results of the present study also demonstrated that the proteasome inhibitor, MG-132, markedly inhibited the downregulation of MCL-1 protein expression levels induced by OGT 2115. However, the protein synthesis inhibitor, cycloheximide, did not affect the role of OGT 2115 in regulating MCL-1. In summary, the results of the present study demonstrated that the proapoptotic activity of OGT 2115 was achieved by downregulating MCL-1.

LncRNA DLEU2 contributes to Taxol resistance of gastric cancer cells through regulating the miR-30c-5p-LDHA axis.

Gastric cancer (GC) is a human malignancy which is associated with high mortality rate and poor prognosis. In addition to surgery, chemo- and radio-therapies are effective strategies against GC at advanced or metastatic stage. Taxol is a traditionally anti-cancer drug which is applied to various types of cancer. However, development of drug resistance limited the anti-cancer effects of Taxol. Currently, the biological roles and mechanisms of non-coding RNA DLEU2 in Taxol resistant GC remain unclear. This study reported that DLEU2 was significantly upregulated and miR-30c-5p was remarkedly downregulated in gastric tumours and cell lines. Silencing DLEU2 or overexpression of miR-30c-5p effectively increased the Taxol sensitivity of GC cells. Through bioinformatics analysis, RNA pull-down and luciferase assay, we demonstrated that DLEU2 sponged miR-30c-5p to block its expression in GC cells. Moreover, from the established Taxol resistant GC cell line, we detected remarkedly upregulated DLEU2 and downregulated miR-30c-5p expressions and significantly elevated glucose metabolism. Under low glucose condition, Taxol resistant cells were more susceptible to Taxol. In addition, we showed overexpression of miR-30c-5p blocked glucose metabolism through inhibiting the LDHA, a glucose metabolism key enzyme by direct targeting the 3'UTR of LDHA. Finally, rescue experiments validated that restoration of miR-30c-5p in DLEU2-overexpressing Taxol resistant GC cells effectively overcame the DLEU2-promoted Taxol resistance. In summary, this study uncovered new roles and molecular mechanisms of the lncRNA DLEU2-promoted Taxol resistance of gastric cancer cells, presenting the DLEU2-miR-30c-5p-LDHA-glucose metabolism axis a potentially therapeutic target for treatment of Taxol resistant GC.

A convenient and effective method for determining organophosphorus pesticides in citrus fruits based on a novel dispersive solid phase extraction using UiO-66/Alg bead as the sorbent.

This work presents a novel, convenient and effective method for assaying organophosphorus pesticides (OPPs) in the pulp and peel of citrus fruits. In this method, shaped UiO-66/alginate (UiO-66/Alg) beads were employed to replace the powder sorbents used in traditional dispersive solid phase extraction (d-SPE) methods. The UiO-66/Alg beads can be easily separated by only using a tweezer within 1 min, which effectively simplifies the sample pretreatment and overcomes the shortages brought by the incomplete separation of powder sorbents. Moreover, the matrix compounds can be effectively excluded by UiO-66/Alg beads, and the UiO-66/Alg beads can be reused at least 8 times. The d-SPE conditions were optimized by a single factor test. The method shows satisfactory sensitivity, accuracy and precision. Furthermore, ATR-FTIR and UV-Vis-DRS were employed to investigate the adsorption mechanism. Finally, the developed method was applied to monitor the OPPs in ten different citrus fruits.

Age-related changes in the bottom view area of ancient children's skulls from the Zaghunluq Cemetery in Xinjiang, China.

This study examined forty skull samples of ancient children, aged 2-15 years, excavated from the Zaghunluq cemetery in Xinjiang, China. The purpose of the study was to analyze the patterns of age-related physiological development and growth spurts in the skulls of these ancient children by comparing the projected areas of the bottom view of the skull, the occipital bone, and the maxilla among different age groups. The analysis of variance (ANOVA) revealed significant differences in the projected areas of the skull's bottom view, occipital bone, and maxilla among five age groups (2 years old, 3-5 years old, 6-8 years old, 9-11 years old, and 12-15 years old). The growth spurts in the projected area of the occipital bone occurred at ages 3-5 years and 6-8 years. As for the maxilla, the growth spurts took place at ages 6-8 years and 12-15 years. Meanwhile, the projected area of the skull's bottom view exhibited a continuous increase without any periods of rapid growth. These findings may reflect the patterns of age-related growth in the skulls of ancient children in Xinjiang, China.

Exploration in the Mechanism of Ginsenoside Rg5 for the Treatment of Osteosarcoma by Network Pharmacology and Molecular Docking.

OBJECTIVE: Osteosarcoma is a primary malignancy originating from mesenchymal tissue characterized by rapid growth, early metastasis and poor prognosis. Ginsenoside Rg5 (G-Rg5) is a minor ginsenoside extracted from Panax ginseng C.A. Meyer which has been discovered to possess anti-tumor properties. The objective of current study was to explore the mechanism of G-Rg5 in the treatment of osteosarcoma by network pharmacology and molecular docking technology. METHODS: Pharmmapper, SwissTargetPrediction and similarity ensemble approach databases were used to obtain the pharmacological targets of G-Rg5. Related genes of osteosarcoma were searched for in the GeneCards, OMIM and DrugBank databases. The targets of G-Rg5 and the related genes of osteosarcoma were intersected to obtain the potential target genes of G-Rg5 in the treatment of osteosarccoma. The STRING database and Cytoscape 3.8.2 software were used to construct the protein-protein interaction (PPI) network, and the Database for Annotation, Visualization and Integrated Discovery (DAVID) platform was used to perform gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses. AutoDock vina software was used to perform molecular docking between G-Rg5 and hub targets. The hub genes were imported into the Kaplan-Meier Plotter online database for survival analysis. RESULTS: A total of 61 overlapping targets were obtained. The related signaling pathways mainly included PI3K-Akt signaling pathway, Proteoglycans in cancer, Lipid and atherosclerosis and Kaposi sarcoma-associated herpesvirus infection. Six hub targets including PIK3CA, SRC, TP53, MAPK1, EGFR, and VEGFA were obtained through PPI network and targets-pathways network analyses. The results of molecular docking showed that the binding energies were all less than -7 kcal/mol. And the results of survival analysis showed TP53 and VEGFA affect the prognosis of sarcoma patients. CONCLUSION: This study explored the possible mechanism of G-Rg5 in the treatment of osteosarcoma using network pharmacology method, suggesting that G-Rg5 has the characteristics of multi-targets and multi-pathways in the treatment of osteosarcoma, which lays a foundation for the follow-up experimental and clinical researches on the therapeutic effects of G-Rg5 on osteosarcoma.

Chinese Adults' Willingness to Pay for Mandatory Nutrients Reporting on Nutrition Facts Table.

The Chinese food industry has opposed the mandatory inclusion of increased nutrients in the Nutrition Facts Table (NFT), thus impeding its improvement. This poses a challenge to the endeavors aiming to assist consumers in cultivating healthy dietary habits that incorporate reduced saturated fatty acids and added sugars while ensuring the adequate intake of essential micronutrients. This study conducted a choice experiment to investigate Chinese consumers' preference for updated labeling schemes among 630 adults that were randomly selected from Central, North, East, South, Northwest, Southwest, and Northeast China. It revealed that respondents were willing to pay the highest premium for the most mandatory nutrients (22.575% of the food price per unit). Respondents preferred the NFT with the most mandatory nutrients if they met the following population characteristics: female; non-overweight or obese; without a college degree; possessed an annual household disposable income between 50,000 and 99,999 CNY; from North China; lived in rural areas and often cooked for family; cared about food nutrition. Two combinations of NFT information received the highest preference: (1) the NFT detailing the most mandatory nutrients and their content values and nutrient reference values (NRV%); (2) the NFT containing the most nutrients and the nutrients in 100 g/mL or a serving. The first and second combinations attracted a premium of 14.884% and 31.833% of the food price per unit, respectively.

Blood Biomarkers Panels for Screening of Colorectal Cancer and Adenoma on a Machine Learning-Assisted Detection Platform.

OBJECTIVE: A mini-invasive and good-compliance program is critical to broaden colorectal cancer (CRC) screening and reduce CRC-related mortality. Blood testing combined with imaging examination has been proved to be feasible on screen for multicancer and guide intervention. The study aims to construct a machine learning-assisted detection platform with available multi-targets for CRC and colorectal adenoma (CRA) screening. METHODS: This was a retrospective study that the blood test data from 204 CRCs, 384 CRAs, and 229 healthy controls was extracted. The classified models were constructed with 4 machine learning (ML) algorithms including support vector machine (SVM), random forest (RF), decision tree (DT), and eXtreme Gradient Boosting (XGB) based on the candidate biomarkers. The importance index was used by SHapely Adaptive exPlanations (SHAP) analysis to identify the dominant characteristics. The performance of classified models was evaluated. The most dominating features from the proposed panel were developed by logistic regression (LR) for identification CRC from control. RESULTS: The candidate biomarkers consisted of 26 multi-targets panel including CEA, AFP, and so on. Among the 4 models, the SVM classifier for CRA yields the best predictive performance (the area under the receiver operating curve, AUC: .925, sensitivity: .904, and specificity: .771). As for CRC classification, the RF model with 26 candidate biomarkers provided the best predictive parameters (AUC: .941, sensitivity: .902, and specificity: .912). Compared with CEA and CA199, the predictive performance was significantly improved. The streamlined model with 6 biomarkers for CRC also obtained a good performance (AUC: .946, sensitivity: .885, and specificity: .913). CONCLUSIONS: The predictive models consisting of 26 multi-targets panel would be used as a non-invasive, economical, and effective risk stratification platform, which was expected to be applied for auxiliary screening of CRA and CRC in clinical practice.

Wide-field endoscope accessory for multiplexed fluorescence imaging.

A wide-field endoscope that is sensitive to fluorescence can be used as an adjunct to conventional white light endoscopy by detecting multiple molecular targets concurrently. We aim to demonstrate a flexible fiber-coupled accessory that can pass forward through the instrument channel of standard medical endoscopes for clinical use to collect fluorescence images. A miniature scan mirror with reflector dimensions of 1.30 × 0.45  mm2 was designed, fabricated, and placed distal to collimated excitation beams at λex = 488, 660, and 785 nm. The mirror was driven at resonance for wide angular deflections in the X and Y-axes. A large image field-of-view (FOV) was generated in real time. The optomechanical components were packaged in a rigid distal tip with dimensions of 2.6 mm diameter and 12 mm length. The scan mirror was driven at 27.6 and 9.04 kHz in the fast (X) and slow (Y) axes, respectively, using a square wave with 50% duty cycle at 60 Vpp to collect fluorescence images at 10 frames per sec. Maximum total divergence angles of ± 27.4° and ± 22.8° were generated to achieve a FOV of 10.4 and 8.4 mm, respectively, at a working distance of 10 mm. Multiplexed fluorescence images were collected in vivo from the rectum of live mice using 3 fluorescently-labeled peptides that bind to unique cell surface targets. The fluorescence images collected were separated into 3 channels. Target-to-background ratios of 2.6, 3.1, and 3.9 were measured. This instrument demonstrates potential for broad clinical use to detect heterogeneous diseases in hollow organs.